View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_high_97 (Length: 240)
Name: NF2748_high_97
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_high_97 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 53 - 212
Target Start/End: Original strand, 20992998 - 20993157
Alignment:
| Q |
53 |
cctcaacatcataacactagttatttcaattttaatattgactttgagtttatggttcgaaagccgaccaagccaacatagaatgcgagagattgtttga |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
20992998 |
cctcaacatcataacactagttatttcaatctcaatattgactttgagtttatagttcgaaagccgaccaagccaacacggaatgcgagagattatttga |
20993097 |
T |
 |
| Q |
153 |
aaagtgacaaaattgattttttaatggtaaatttgtgtttgggatgcttcgcagaattca |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
20993098 |
aaagtgacaaaagtgattttttaatggtaaatttgtgtttgggatgctccgcagaattca |
20993157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University