View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_low_100 (Length: 243)
Name: NF2748_low_100
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_low_100 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 39291359 - 39291138
Alignment:
| Q |
19 |
aacttcgtaaagatttgaaacgttttggattatgttatgattacgtttatcctctgtaactactccgaatggtaccaatgcgcgtatcaaagcaattgca |
118 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
39291359 |
aacttcgcaaagatttgaaacgttt-ggattatgttatgattacgtttatcctctgtaactacttcgaatggtaccaatgcgcgtatcaaagcgattgca |
39291261 |
T |
 |
| Q |
119 |
ccccttccaaggtttactccctctgcgcaatgtgtccataatgacagttcgttttttagttatctatgtttataattatgactatctcgcatatatttga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39291260 |
ccccttccaaggtttactccctctgcgcaatgtgtccataatgacagttcgttttttagttatctatgtttataattatgactatctcgcatatatttga |
39291161 |
T |
 |
| Q |
219 |
agtttcttcctttgcttctccac |
241 |
Q |
| |
|
|||||||||||| ||||||||| |
|
|
| T |
39291160 |
agtttcttccttctcttctccac |
39291138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University