View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_low_107 (Length: 227)
Name: NF2748_low_107
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_low_107 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 37 - 210
Target Start/End: Original strand, 1109351 - 1109524
Alignment:
| Q |
37 |
aaatgtggaggagtctcacttggtgctgggatgcaccattacgcagcagatggaacttctggtcttcacttcatcaatacatggttagatgtaactcgtg |
136 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1109351 |
aaatgtgaaggagtctcacttggtgctgggatgcaccattacatagcagatggaacttctggtcttcacttcatcaatatatggttagatgtaactcgtg |
1109450 |
T |
|
| Q |
137 |
gcctagatgtttccattccaccattcattgacaggacagtactccatgctcgcgatccgccacgacccattttc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| || |||| ||||||||||||||||||||||| |
|
|
| T |
1109451 |
gcctagatgtttccattccaccattcattgaaaggacagtaccccgtgcttgcgatccgccacgacccattttc |
1109524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 37 - 203
Target Start/End: Original strand, 1129925 - 1130091
Alignment:
| Q |
37 |
aaatgtggaggagtctcacttggtgctgggatgcaccattacgcagcagatggaacttctggtcttcacttcatcaatacatggttagatgtaactcgtg |
136 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||| ||| | | |||||||||| ||||||||||||| |||||||||||||||| ||||||| |||||| |
|
|
| T |
1129925 |
aaatgtggaggagtctcacttggtgttggtatgcaacatcatgtagcagatggagcttctggtcttcatttcatcaatacatggtcagatgtagctcgtg |
1130024 |
T |
|
| Q |
137 |
gcctagatgtttccattccaccattcattgacaggacagtactccatgctcgcgatccgccacgacc |
203 |
Q |
| |
|
||||||| |||||||| ||||||||||||||| ||||| |||||| ||| |||||||| || ||||| |
|
|
| T |
1130025 |
gcctagacgtttccatgccaccattcattgaccggacactactccgtgcccgcgatcctccccgacc |
1130091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 37 - 209
Target Start/End: Complemental strand, 31965937 - 31965765
Alignment:
| Q |
37 |
aaatgtggaggagtctcacttggtgctgggatgcaccattacgcagcagatggaacttctggtcttcacttcatcaatacatggttagatgtaactcgtg |
136 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| | ||| |||||| |||||| | ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
31965937 |
aaatgtggaggagtctcacttggtgttgggatgcaccattatgtagccgatggagcttctgcttttcacttcatcaatacatggtcagatgtaactcgtg |
31965838 |
T |
|
| Q |
137 |
gcctagatgtttccattccaccattcattgacaggacagtactccatgctcgcgatccgccacgacccatttt |
209 |
Q |
| |
|
| ||||||| |||||| |||||||| ||||| ||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
31965837 |
gtctagatgcttccatcccaccatttattgatcggacactactccatgcccgcgatccgccacgaccaatttt |
31965765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 81 - 203
Target Start/End: Complemental strand, 27357164 - 27357042
Alignment:
| Q |
81 |
agcagatggaacttctggtcttcacttcatcaatacatggttagatgtaactcgtggcctagatgtttccattccaccattcattgacaggacagtactc |
180 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||| |||||| ||||||| |||||||||| ||||||||||| ||||| ||||||| | | ||| ||||| |
|
|
| T |
27357164 |
agcagatggagcatctggtcttcacttcatcaattcatggtcagatgtagctcgtggccttgatgtttccatcccaccgttcattggccgaacactactc |
27357065 |
T |
|
| Q |
181 |
catgctcgcgatccgccacgacc |
203 |
Q |
| |
|
|||||||| ||||| || ||||| |
|
|
| T |
27357064 |
catgctcgtgatccacctcgacc |
27357042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 81 - 203
Target Start/End: Original strand, 45409999 - 45410121
Alignment:
| Q |
81 |
agcagatggaacttctggtcttcacttcatcaatacatggttagatgtaactcgtggcctagatgtttccattccaccattcattgacaggacagtactc |
180 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||| |||||| ||||||| |||||||||| ||||||||||| ||||| ||||||| | | ||| ||||| |
|
|
| T |
45409999 |
agcagatggagcatctggtcttcacttcatcaattcatggtcagatgtagctcgtggccttgatgtttccatcccaccgttcattggccgaacactactc |
45410098 |
T |
|
| Q |
181 |
catgctcgcgatccgccacgacc |
203 |
Q |
| |
|
|||||||| ||||| || ||||| |
|
|
| T |
45410099 |
catgctcgtgatccacctcgacc |
45410121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University