View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_low_109 (Length: 223)
Name: NF2748_low_109
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_low_109 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 43938844 - 43939057
Alignment:
| Q |
1 |
cgaaatagtgtttcaatcagtattgattcttgttctttgctgtgttggtctttatttcgcagtatgggaattaccagaggaaaatacttgaagaggactt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43938844 |
cgaaatagtgtttcaatcagtattgattcttgttctttgttgtgttggtctttatttcgcagtatgggaattaccagaggaaaatacttgaagaggactt |
43938943 |
T |
|
| Q |
101 |
gaacaagaaatggaatcgtatcatagtcaatacttcggtatgtttttcactctaattgtctctttgtcatttcatgaatgagcttttatgatgtttattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43938944 |
gaacaagaaatggaatcgtatcatagtcaatacttcggtatgtttttcactctaattgtctctttggcatttcatgaatgagcttttatgatgtttattt |
43939043 |
T |
|
| Q |
201 |
caacttatattctt |
214 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
43939044 |
caacttattttctt |
43939057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University