View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_low_111 (Length: 219)
Name: NF2748_low_111
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_low_111 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 18 - 210
Target Start/End: Original strand, 17353388 - 17353580
Alignment:
| Q |
18 |
atcatgtcattttgtagttttcgaaaatccattccaccaagtaattcatcaaaatgttagtattattaaatctcatgcnnnnnnnccaaattgtactcaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||| |
|
|
| T |
17353388 |
atcatgtcattttgtagttttcgaaaatctattccaccaagtaattcatcaaaatgttagtattattaaatctcatgcaaaaaaatcatatggtactcaa |
17353487 |
T |
 |
| Q |
118 |
cacaaggatatgcaaattacattcagtcctcacaaaataatctcaatctcctaattacagtcatgcaacaaacttgattctcaaactcttcat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
17353488 |
cacaaggatatgcaaattacattcagtcctcacaaaataatctcaatctcctaatttcagtcatgcaacaaacttgattctcaaactcctcat |
17353580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University