View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_low_47 (Length: 381)
Name: NF2748_low_47
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_low_47 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 18 - 369
Target Start/End: Complemental strand, 44776926 - 44776572
Alignment:
| Q |
18 |
agataagctgtagtaaaccaatcgaaacaaaccctaggtgtttttatttt--tgttatttaggttgtatacgacggtcctaatgttacatcgtgggatat |
115 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44776926 |
agataagctgtggtaaaccaatccaaacaaaccctaggtgtttttattttatttttatttaggttgtatacgacggtcctaatgttacatcgtgggatat |
44776827 |
T |
|
| Q |
116 |
tttgcagtgaagtttatatcaaagcatcttcgaaaggacggccatttacaattagggaggtgaaggcttcaaacattggtcagctagtcaggatagctgg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44776826 |
tttgcagtgaagtttatatcaaagcatcttcgaaaggacggccatttacaattagggaggtgaaggcttcaaacattggtcagctagtgaggatagctgg |
44776727 |
T |
|
| Q |
216 |
tatcgttacacgttgctcagatgtcaaaccattgatgcaggtggctgtgtacacctgtgaggattgtggctttgaaatctatcaggtaattcatataagt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44776726 |
tatcgttacacgttgctcagatgtcaaaccattgatgcaggtggctgtgtacacctgtgaggattgtggctttgaaatctatcaggtaattcatataagt |
44776627 |
T |
|
| Q |
316 |
actgcatta-tttatctagatgcacaataaggtttaaaatagaaatggagggttc |
369 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44776626 |
actgcattactttatccagatgcacaataaggtttaaaatagaaatggagggttc |
44776572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University