View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_low_52 (Length: 350)
Name: NF2748_low_52
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_low_52 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 1e-29; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 122 - 219
Target Start/End: Complemental strand, 1871050 - 1870948
Alignment:
| Q |
122 |
atatttaaaaccgatctag-----actactctacttgccattaccagtcgattaacgggtccaaaagaaaagtgactaaacgggtaatttctaggaactt |
216 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1871050 |
atatttaaaaccgatcgagacagcactactctacttgccattactagtcgattaatgggtccaaaagaaaagtgactcaacgggtaatttctaggaactt |
1870951 |
T |
 |
| Q |
217 |
agc |
219 |
Q |
| |
|
||| |
|
|
| T |
1870950 |
agc |
1870948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 13 - 59
Target Start/End: Complemental strand, 1871156 - 1871110
Alignment:
| Q |
13 |
aatatttaatgttaatactaccaattaaattttatatttattctttc |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1871156 |
aatatttaatgttaatactaccaattaaattttatatttattctttc |
1871110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 237 - 274
Target Start/End: Complemental strand, 1850476 - 1850439
Alignment:
| Q |
237 |
gagaagattaagtcgaaccattaattgaatcgaaaaca |
274 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1850476 |
gagaagattaagttgaaccattaattgaatcgaaaaca |
1850439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 232
Target Start/End: Complemental strand, 1850564 - 1850511
Alignment:
| Q |
179 |
aaaagaaaagtgactaaacgggtaatttctaggaacttagctgcttgtctcttc |
232 |
Q |
| |
|
|||| |||||||||| || ||||||||||||| ||| ||||| ||||||||||| |
|
|
| T |
1850564 |
aaaaaaaaagtgactcaaagggtaatttctagcaacgtagcttcttgtctcttc |
1850511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 284 - 316
Target Start/End: Complemental strand, 1870933 - 1870901
Alignment:
| Q |
284 |
ggcaaaattggttttaatccatcaattttgtag |
316 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
1870933 |
ggcaaaattggttttaatacatcaattttgtag |
1870901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University