View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_low_53 (Length: 344)
Name: NF2748_low_53
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_low_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 9e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 19 - 250
Target Start/End: Original strand, 46914386 - 46914617
Alignment:
| Q |
19 |
gggggtgtgttggtgggggttggagaaggacattttggtgtttcaatgttgttttgnnnnnnnnataattgcagagattaaatagttttgtttgttttca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
46914386 |
gggggtgtgttggtgggggttggagaaggacattttggtgtttcaatgttgttttgttttttttataattgcagagtttaaatagttttgtttgttttca |
46914485 |
T |
 |
| Q |
119 |
gttatcatagtactaatctctaggnnnnnnnnatctttttgtgaaagaaaataaaaggtatgctgtaatttcttggaatttattgtttgatgttgttggt |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46914486 |
gttatcatagtactaatctctaggttttttttatctttttgtgaaagaaaataaaaagtatgctgtaatttcttggaatttattgtttgatgttgttggt |
46914585 |
T |
 |
| Q |
219 |
agagatcgtgggtgacaaacagagttcgttta |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46914586 |
agagatcgtgggtgacaaacagagttcgttta |
46914617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University