View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_low_59 (Length: 318)
Name: NF2748_low_59
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_low_59 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 18 - 287
Target Start/End: Complemental strand, 53742133 - 53741864
Alignment:
| Q |
18 |
actttgatctatacattcagtgttgttgcctaaaatggatatccgtgagttgatatcatcatgtctattttgatgccttagatggtagttgagaataatc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53742133 |
actttgatctatacattcagtgttgttgcctaaaatggatatccgtgagtttatatcatcatgtctattttgatgccttagatggtagtttagaataatc |
53742034 |
T |
 |
| Q |
118 |
atagagactcgagaacgaagtttctatacatgatgagtataccgtatgttaattccataaaacannnnnnngaagacaaattactctatgcctggtaatc |
217 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53742033 |
atagagattcgagaatgaagtttctatacatgatgagtataccgtatgttaattccataaaacattgttttgaagacaaattactctatgcctggtaatc |
53741934 |
T |
 |
| Q |
218 |
atgtatcgtggagagtacttcaagaatggagttactggtttatcatacttgctgcacatatttttcatcc |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
53741933 |
atgtatcgtggagagtacttcaagaatggagttactggtttatcatacttgctgcacaaatttttcatcc |
53741864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University