View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_low_62 (Length: 306)
Name: NF2748_low_62
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_low_62 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 1 - 293
Target Start/End: Original strand, 45993024 - 45993311
Alignment:
| Q |
1 |
ccggtaaaaaccatggacctttcttcactctccatccctcgcatgtgctcttcgagttgcatagagcaatttgattgcgcattaacatcccattattttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45993024 |
ccggtaaaaaccatggacctttcttcactctccatccctcgcatgtgctcttcgagttgcatagagcaatttgattgcgcattaacatcccattattttt |
45993123 |
T |
 |
| Q |
101 |
ccacatatcttttgttaaatatttaaccttactccttgaactcacaatacatttggacttcctcaagaaacgcatatgctcaattaaagtccttgttttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45993124 |
ccacatatcttttgttaaatatttaaccttactccttgaactcacaatacatttggacttcctcaagaaacgcatatgctc-----aagtccttgttttc |
45993218 |
T |
 |
| Q |
201 |
ttgactcatgattttcggaacacaacaagatcatatcatacatgtatatatatggcctccttgtgacctttttcagcagcaatctttcatctc |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
45993219 |
ttgactcatgattttcggaacacaacaagatcataccatacatacatgtatatggcctccttgtgacctttttcagcagcaatctttaatctc |
45993311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 9 - 65
Target Start/End: Original strand, 35454406 - 35454462
Alignment:
| Q |
9 |
aaccatggacctttcttcactctccatccctcgcatgtgctcttcgagttgcataga |
65 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
35454406 |
aaccatcgacctttcttcactctccatcccttgcatgtgctcttggagttgcataga |
35454462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University