View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_low_64 (Length: 298)
Name: NF2748_low_64
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_low_64 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 11 - 298
Target Start/End: Original strand, 4321570 - 4321857
Alignment:
| Q |
11 |
atgaacagaactaggtaaacaatgaaatagagtaagtaggtagaacttgaaccccaacaacaatgaccacaatgcccatacacatgtcgccatccacccc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4321570 |
atgaacagaactaggtaaacaatgaaatagagtaagtaggtagaacttgaaccccaacaacaatgaccacaatgcccatacacatgtcgccatccacccc |
4321669 |
T |
 |
| Q |
111 |
aaaatcattcccttcatcgactaaattcaagaaacggagcagtgtgtcctgttcctcaagaacagcaacccataacaagtaccggtctttgtcaacttgg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4321670 |
aaaatcattcccttcatcgactaaattcaagaaacggagcagtgtgtcctgttccgcaagaacagcaacccataacaagtaccggtctttgtcaacttgg |
4321769 |
T |
 |
| Q |
211 |
taccgttttgatgggctgccgttgatgttgcatacggcattcgcctctttgttgtaggctaagtaacactatttaggagacacaacaa |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4321770 |
taccgttttgatgggctgccgttgatgttgcatacggcattcgcctctttgttgtaggctaagtaacactatttaggagacacaacaa |
4321857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University