View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_low_67 (Length: 292)
Name: NF2748_low_67
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_low_67 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 12 - 231
Target Start/End: Complemental strand, 999680 - 999461
Alignment:
| Q |
12 |
atgaacaaccctgaagatgattttgtctctattaatttagacctgggaattggattgttgcaaatcactataaagaaattattctacgaattgtgtttta |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
999680 |
atgaacaaccctgaagatgattttgtctctattaatttagacctgggaattggattgttgcaaatcactataaagaaattattctaagaattgtgtttta |
999581 |
T |
|
| Q |
112 |
aatcattttcattatcattttatgaacaaaaatggtttataagaacacaggttgttcaaacctaaaaagagacatgtttgatcaaaatgattatttcaag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
999580 |
aatcattttcattatcattttatgaacaaaaatggtttataagaacacaggttgttcaaacctaaaaagagacatgtttgatcaaaatgattatttcaag |
999481 |
T |
|
| Q |
212 |
gtttccttgtgatcataaag |
231 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
999480 |
gtttccttgtgatcataaag |
999461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University