View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_low_72 (Length: 283)
Name: NF2748_low_72
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_low_72 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 9 - 270
Target Start/End: Original strand, 45689824 - 45690085
Alignment:
| Q |
9 |
taattaataaaagaaaaaatgcatgcatactcgccaacgcttgagggtctcgggaggagcatttttggtttgtgtaatatcaaaaggatcgtcaggatca |
108 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45689824 |
taattaataatagaaaaaatgcatgcatactcgccaacgcttgagggtctcgggaggagcatttttggtttgtgtaatatcaaaaggatcgtcaggatca |
45689923 |
T |
 |
| Q |
109 |
acgaggaggtcatcgtcatcgtcgttggcagcggggctgtgagggtgagtgctgctagcaatggtgacggtgaggagaccattggaggatgaggatgaac |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45689924 |
acgaggaggtcatcgtcatcgtcgttggcagcggggccgtgagggtgagtgctgctagcaatggtgacggtgaggagaccattggaggatgaggatgaac |
45690023 |
T |
 |
| Q |
209 |
catgagatgtggaacctgtagtagtcttcatgttttgcatgctattgctcatcttcctcttc |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45690024 |
catgagatgtggaacctgtagtagtcttcatgttttgcatgctattgctcatcttcctcttc |
45690085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University