View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_low_83 (Length: 266)
Name: NF2748_low_83
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_low_83 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 184 - 252
Target Start/End: Complemental strand, 6035959 - 6035891
Alignment:
| Q |
184 |
caaggatctactaatggactggatctatattgacaacccttcaatttcttgagtgcatggagttctaat |
252 |
Q |
| |
|
||||| || |||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6035959 |
caaggttccactattggactggatctatattgacaacccttcaatttcttgagtgcatgaagttctaat |
6035891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 40 - 71
Target Start/End: Complemental strand, 6107915 - 6107884
Alignment:
| Q |
40 |
atcccgatacaatacgtgatgtgagcaccaac |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6107915 |
atcccgatacaatacgtgatgtgagcaccaac |
6107884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University