View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_low_88 (Length: 253)
Name: NF2748_low_88
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_low_88 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 4168340 - 4168094
Alignment:
| Q |
1 |
aatgatgattctaagaacaaggatgaacacaaggttccactactgctaaatgcagaggttccagaagcaaagagaaacttgatacaaacagctataagtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4168340 |
aatgatgattctaagaacaaggatgaacacaaggttccactactgctaaatgcagaggttccagaagcaaagagaaacttgatacaaacagctataagtt |
4168241 |
T |
 |
| Q |
101 |
cgacatttcagagcacggcacatttggcaaaccttctacctacaggcactgtccttgcattacaacttttatcaccaatctttac-aatattggcagctg |
199 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4168240 |
tgacatttcagagcacggcacatttagcaaaccttctacctacaggcactgtccttgcattacaacttttatcaccaatctttacaaatattggcagctg |
4168141 |
T |
 |
| Q |
200 |
tgactctgtcagcaagtggatgactgctgcacttgtgactctctgtg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4168140 |
tgactctgtcagcaagtggatgactgctgcacttgtgactctctgtg |
4168094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 2 - 246
Target Start/End: Complemental strand, 4179263 - 4179021
Alignment:
| Q |
2 |
atgatgattctaagaacaaggatgaacacaaggttccactactgctaaatgcagaggttccagaagcaaagagaaacttgatacaaacagctataagttc |
101 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| |||| ||||| ||||||||||||||| |||| | | || |||| | |||||||||||| |
|
|
| T |
4179263 |
atgatgattctaagaac---gatgaacaaaaggttccactcctgcggaatgcggaggttccagaagcagagaggagcctggtacagaaagctataagttc |
4179167 |
T |
 |
| Q |
102 |
gacatttcagagcacggcacatttggcaaaccttctacctacaggcactgtccttgcattacaacttttatcaccaatctttac-aatattggcagctgt |
200 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||||| || || || |||||||| |||||||| ||||| ||| |||||| |||| |
|
|
| T |
4179166 |
gacatttcaaagcacggcgcatttggcaaaccttctacctacaggcactgttctggctttccaacttttgtcaccaatttttacaaatgttggcaactgt |
4179067 |
T |
 |
| Q |
201 |
gactctgtcagcaagtggatgactgctgcacttgtgactctctgtg |
246 |
Q |
| |
|
||||||||| |||||| |||||| ||| |||||||||||| |||| |
|
|
| T |
4179066 |
gactctgtctgcaagtccatgacttctgtacttgtgactctatgtg |
4179021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University