View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_low_89 (Length: 253)
Name: NF2748_low_89
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_low_89 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 6e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 1 - 183
Target Start/End: Original strand, 44052541 - 44052723
Alignment:
| Q |
1 |
ttaacttcttctcaatcaacatgatagctttagcaaaggatgctggcaatgaccaggatatgacggaaatgatatcttacgaaattgaatctttgtccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44052541 |
ttaacttcttctcaatcaacatgatagctttagcaaaggatgctggcaatgaccaggatatgacggaaatgatatcttacgaaattgaatctttgtccaa |
44052640 |
T |
 |
| Q |
101 |
gcaactctctgagctagaggaaaaactgaaggttcnnnnnnnnncatttccttgttttgggaattgggattgtaagttacagt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44052641 |
gcaactctctgagctagaggaaaaactgaaggttctttttttttcatttccttgttttgggaattgggattgtaagttacagt |
44052723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 200 - 243
Target Start/End: Original strand, 44052743 - 44052786
Alignment:
| Q |
200 |
acttgtgttttaccataatttatgaagactaagtatggtctgtg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44052743 |
acttgtgttttaccataatttatgaagactaagtatggtgtgtg |
44052786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University