View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2748_low_94 (Length: 248)

Name: NF2748_low_94
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2748_low_94
NF2748_low_94
[»] chr2 (5 HSPs)
chr2 (175-231)||(35639558-35639614)
chr2 (53-86)||(35601498-35601531)
chr2 (18-70)||(35601553-35601606)
chr2 (18-70)||(35639408-35639461)
chr2 (53-86)||(35639481-35639514)


Alignment Details
Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 175 - 231
Target Start/End: Original strand, 35639558 - 35639614
Alignment:
175 aaataaaataactcattgtattgctaaactctctttatgtgatcatagcccccatat 231  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
35639558 aaataaaataactcattgtattgctaaattctctttatgtgatcatagcccccatat 35639614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 53 - 86
Target Start/End: Complemental strand, 35601531 - 35601498
Alignment:
53 gattgtaaatttatagctaatactcttgccttat 86  Q
    ||||||||||||||||||||||||||||||||||    
35601531 gattgtaaatttatagctaatactcttgccttat 35601498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 35601606 - 35601553
Alignment:
18 atatggaacggaatgcatgctgttt-gttcgaaaccgattgtaaatttatagct 70  Q
    ||||||||| |||| |||||||||| |||||||| |||||||||||||||||||    
35601606 atatggaacagaatacatgctgttttgttcgaaaacgattgtaaatttatagct 35601553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 35639408 - 35639461
Alignment:
18 atatggaacggaatgcatgctgttt-gttcgaaaccgattgtaaatttatagct 70  Q
    ||||||||| |||| |||||||||| |||||||| |||||||||||||||||||    
35639408 atatggaacagaatacatgctgttttgttcgaaaacgattgtaaatttatagct 35639461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 53 - 86
Target Start/End: Original strand, 35639481 - 35639514
Alignment:
53 gattgtaaatttatagctaatactcttgccttat 86  Q
    ||||||||||||||||||||||||||||||||||    
35639481 gattgtaaatttatagctaatactcttgccttat 35639514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University