View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2748_low_99 (Length: 244)
Name: NF2748_low_99
Description: NF2748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2748_low_99 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 25 - 230
Target Start/End: Complemental strand, 38501955 - 38501750
Alignment:
| Q |
25 |
taataatatctaggatgcagttcatattcaataaattgactagtttccgaactaatcctaagtatcaaatagagatatcccttacaaatcaaactttaat |
124 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38501955 |
taataatatctaggatgcggttcatattcaataaattgactagtttccgaactaatcctaagtatcaaatagagatatcccttacaaatcaaactttaat |
38501856 |
T |
 |
| Q |
125 |
ctttaataaaataaaggagatgatattgatgtaagatcgagaagcaacagtggtcctcttggctgaatgaagagtactcctggtatggcacgttggtaaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38501855 |
ctttaataaaataaaggagatgatattgatgtaagaccgagaagcaacagtggtcctcttggcagaatgaagagtactcctggtatggcacgttggtaaa |
38501756 |
T |
 |
| Q |
225 |
cctatg |
230 |
Q |
| |
|
|||||| |
|
|
| T |
38501755 |
cctatg |
38501750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University