View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2749_high_25 (Length: 423)
Name: NF2749_high_25
Description: NF2749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2749_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 19 - 340
Target Start/End: Complemental strand, 1797486 - 1797164
Alignment:
| Q |
19 |
gtctaatcatcatcaagcacaaaatattgtctgtttccactggcaccaggaaacactttttatggtaattattgttccaatttagatccataaatgaatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1797486 |
gtctaatcatcatcaagcacaaaatattgtctgtttccactggcaccaggaaacactttttatggtaattattgttccaatttagatccataaatgaatt |
1797387 |
T |
 |
| Q |
119 |
caacaatcatcttgctcattgaccccatttgttccaactagcccacgccctccactaactaccacaattcatcatacatattatagcaattttgtcaata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1797386 |
caacaatcatcttgctcattgaccccatttgttccaactagcccacgccctccactaactaccacaattcatcatacatattatagcaattttgtcaata |
1797287 |
T |
 |
| Q |
219 |
aaagaggtctggtaaatcggaattcagttgaaaagtaaataaatcgtgactaatgattgttctactcaagatttactatcttgct-ttttatatagtgta |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| | |
|
|
| T |
1797286 |
aaagaggtctggtaaatcggaattcagttgaaaagtaaataaatcatgactaatgattgttctactcaagatttactatcttgcttttttatatagtgca |
1797187 |
T |
 |
| Q |
318 |
tagttaaaaagtttaattccatc |
340 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
1797186 |
tagttaaaaagtttaattccatc |
1797164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University