View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2749_high_30 (Length: 379)
Name: NF2749_high_30
Description: NF2749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2749_high_30 |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0168 (Bit Score: 131; Significance: 7e-68; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 199 - 363
Target Start/End: Original strand, 23664 - 23825
Alignment:
| Q |
199 |
ccaaaacgtgctcccccaaggaatgaaggatatcatctatttatagactcatttgccactccttaaaccaataagattggtttctccatgtttgggtttc |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23664 |
ccaaaacgtgctcccccaaggaatgaaggataccatctatttataggctcatttgccactcctttaaccaataagattggtttctccatgtttgggtttc |
23763 |
T |
 |
| Q |
299 |
cataacctcctttgccacttgcattttctttttcattaagttttgttatctttatgtgtagataa |
363 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23764 |
cataacctccttt---acttgtattttctttttcattaagttttgttagctttatgtgtagataa |
23825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University