View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2749_high_47 (Length: 231)
Name: NF2749_high_47
Description: NF2749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2749_high_47 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 231
Target Start/End: Original strand, 10954721 - 10954934
Alignment:
| Q |
18 |
gtttctgatacatatttcagaataattaaaaatttatacaaaggggaaacaatttgtgatgtttcttctgcaaaaccgatgctgtaaactggttttatat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10954721 |
gtttctgatacatatttcagaataattaaaaatttatacaaaggggaaacaatttgtgatgtttcttctgcaaaaccgatgctgtaaactggttttatat |
10954820 |
T |
|
| Q |
118 |
aacaaaatagaagacaatacaatatcaactattcttgttggtgatgatttcaagtttccatttaggaaaataagaatggttaacaaaacagaagcacgga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10954821 |
aacaaaatagaagacaatacaatatcaactattcttgttggtgatgatttcaagtttccatttaggaaaataagaatggttaacaaaacagaagcacgga |
10954920 |
T |
|
| Q |
218 |
tacggacaccggac |
231 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
10954921 |
tacggacaccggac |
10954934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 114
Target Start/End: Original strand, 10944700 - 10944736
Alignment:
| Q |
78 |
gtttcttctgcaaaaccgatgctgtaaactggtttta |
114 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
10944700 |
gtttcttcttcaaaacctatgctgtaaactggtttta |
10944736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University