View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2749_high_49 (Length: 228)

Name: NF2749_high_49
Description: NF2749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2749_high_49
NF2749_high_49
[»] chr6 (1 HSPs)
chr6 (1-116)||(2128619-2128738)


Alignment Details
Target: chr6 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 2128619 - 2128738
Alignment:
1 atataacttttaaatgatatt----tgcttaattttacacaattgagaacacaagtaatcttacgttatttatgactgaaaaagatataaatattatcta 96  Q
    |||||||||||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2128619 atataacttttaaatgatattaatttgcttaattttacacaattgagaacacaagtaatcttacgttatttatgactgaaaaagatataaatattatcta 2128718  T
97 attatgcacatccaggtttc 116  Q
    |||||||||||| |||||||    
2128719 attatgcacatctaggtttc 2128738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University