View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2749_high_49 (Length: 228)
Name: NF2749_high_49
Description: NF2749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2749_high_49 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 2128619 - 2128738
Alignment:
| Q |
1 |
atataacttttaaatgatatt----tgcttaattttacacaattgagaacacaagtaatcttacgttatttatgactgaaaaagatataaatattatcta |
96 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2128619 |
atataacttttaaatgatattaatttgcttaattttacacaattgagaacacaagtaatcttacgttatttatgactgaaaaagatataaatattatcta |
2128718 |
T |
|
| Q |
97 |
attatgcacatccaggtttc |
116 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
2128719 |
attatgcacatctaggtttc |
2128738 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University