View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2749_low_53 (Length: 221)

Name: NF2749_low_53
Description: NF2749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2749_low_53
NF2749_low_53
[»] chr8 (1 HSPs)
chr8 (20-205)||(3684195-3684375)


Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 20 - 205
Target Start/End: Original strand, 3684195 - 3684375
Alignment:
20 tttttatgttttgtgtggggtggcctctacgtacggtttggcataggattctagatggttatggtggaagtggattttgctatggatttggttggtcctt 119  Q
    |||||||||||||||||||||||||||||||    |||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||    
3684195 tttttatgttttgtgtggggtggcctctacg----gtttggcatatgattctagatggttatggtggaagtggattttgctatggattcggttggtcctt 3684290  T
120 ttttaggtgttcttggggttagcggggagagaaaagattacttgtgattttttgttggtttgacatactgtcgtgtggtctatata 205  Q
    || |||||||||||||||||||||||||||||||||||||  |||||| |||||||||||||||||||||||||||||||||||||    
3684291 tt-taggtgttcttggggttagcggggagagaaaagattaggtgtgatattttgttggtttgacatactgtcgtgtggtctatata 3684375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University