View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2749_low_53 (Length: 221)
Name: NF2749_low_53
Description: NF2749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2749_low_53 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 20 - 205
Target Start/End: Original strand, 3684195 - 3684375
Alignment:
| Q |
20 |
tttttatgttttgtgtggggtggcctctacgtacggtttggcataggattctagatggttatggtggaagtggattttgctatggatttggttggtcctt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3684195 |
tttttatgttttgtgtggggtggcctctacg----gtttggcatatgattctagatggttatggtggaagtggattttgctatggattcggttggtcctt |
3684290 |
T |
|
| Q |
120 |
ttttaggtgttcttggggttagcggggagagaaaagattacttgtgattttttgttggtttgacatactgtcgtgtggtctatata |
205 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3684291 |
tt-taggtgttcttggggttagcggggagagaaaagattaggtgtgatattttgttggtttgacatactgtcgtgtggtctatata |
3684375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University