View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2750_high_10 (Length: 294)
Name: NF2750_high_10
Description: NF2750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2750_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 279
Target Start/End: Complemental strand, 49093909 - 49093636
Alignment:
| Q |
1 |
agtatggtcagaaaatgcagcagcagctatctctctcctccctaccagtgtattttaggtgtcgatcccagtgatgtctttaacagtaccttttattttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49093909 |
agtatggtcagaaaatgcagcagcagctatctctctcctccctcccagtgtattttaggtgtcgatcccagtgatgtctttaacagtgccttttattttt |
49093810 |
T |
 |
| Q |
101 |
cgtatcaaagcctctctgcaattgtgaaataattcaattataaattaattcaatccattgaaccaaattatggaaacagattattgaagagcgagcatac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49093809 |
cgtatcaaagcctctctgcaattgtgaaataattcaattataaattaattcaatccattgaaccaaattatggaaacagattattgaagagcgagcatac |
49093710 |
T |
 |
| Q |
201 |
cgctctggcttgaaaactaggttcttgtatgcaaaccactgcaaagaagaagaaacgatatatatatacatgttagttt |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
49093709 |
cgctctggcttgaaaactaggttcttgtatgcaaaccactgcaaagaagaagaa-----atatatatacatgttagttt |
49093636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 195 - 244
Target Start/End: Original strand, 8853060 - 8853109
Alignment:
| Q |
195 |
gcataccgctctggcttgaaaactaggttcttgtatgcaaaccactgcaa |
244 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8853060 |
gcatacctttctggcttgaaaactacgttcttgtatgcaaaccactgcaa |
8853109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University