View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2750_high_15 (Length: 261)
Name: NF2750_high_15
Description: NF2750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2750_high_15 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 55 - 261
Target Start/End: Original strand, 32591557 - 32591762
Alignment:
| Q |
55 |
acaaccccattcaactatttaataattcgattaattatcttgttatggtgactattagtagtctctaaaataataggtcaatcttgtttttaatctatta |
154 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32591557 |
acaaccccat-caactatttaataattcgattaattatcttgttatggtgactattagtagtctctaaaataatatgtcaatcttgtttttaatctatta |
32591655 |
T |
 |
| Q |
155 |
ttaaaaacaacatattagtccctaaaagatgcacttttttgttaaatatcttattcttctctaatccacaatctcatctcatctcttatttaactaattc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32591656 |
ttaaaaacaacatattagtccctaaaagatgcacttttttgttaaatatcttattcttctctaatccacaatctcatctcatctcttatttaactaattc |
32591755 |
T |
 |
| Q |
255 |
attttca |
261 |
Q |
| |
|
||||||| |
|
|
| T |
32591756 |
attttca |
32591762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University