View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2750_high_4 (Length: 502)
Name: NF2750_high_4
Description: NF2750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2750_high_4 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 477; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 477; E-Value: 0
Query Start/End: Original strand, 18 - 502
Target Start/End: Original strand, 31811032 - 31811516
Alignment:
| Q |
18 |
cattggtggctgattcatctcctaagaatggaaattacatgtggaagaataaaatcaatctcactccaccttcattgcagctgaaaaatgctttgagtgc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31811032 |
cattggtggctgattcatctcctaagaatggaaattacatgtggaagaataaaatcaatctcactccaccttcattgcagctgaaaaatgctttgagtgc |
31811131 |
T |
 |
| Q |
118 |
aagggatttgtatcaagaaatggacctgttacatggtgtttcaatgcaaccttcaactcctagccaatttcaatctatgagtaggcttcagctgaaccaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31811132 |
aagggatttgtatcaagaaatggacctgttacatggtgtttcaatgcaaccttcaactcctagccaatttcaatctatgagtaggcttcagctgaaccaa |
31811231 |
T |
 |
| Q |
218 |
aataggaaccatgttcaagcaagttatccattcaacaacattgtttcatctcctatgagaaaatcatcaccatttggatttgattcatcagctgctatgg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31811232 |
aataggaaccatgttcaagcaagttatccattcaacaacattgtttcatctcctatgagaaaatcatcaccatttggatttgattcatcagctgctatgg |
31811331 |
T |
 |
| Q |
318 |
ctgcagcagtgatgaattcaaggtcttcagcctttgcgacacgaagccaaagctttatggatcgcggtgtgtcaagacaatatatcggtgcttccgaatc |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31811332 |
ctgcagcagtgatgaattcaaggtcttcagcctttgcgacacgaagccaaagctttatggatcgcggtgtgtcaagacaatatatcggtgcttccgaatc |
31811431 |
T |
 |
| Q |
418 |
caacagtaggatgaactctgatctctcagattggatttcaaatgattgggatgagctgcataagttgaaaaaatctgcttctttt |
502 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31811432 |
caacagtagaatgaactctggtctctcagattggatttcaaatgattgggatgagctgcataagttgaaaaaatctgcttctttt |
31811516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University