View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2750_low_16 (Length: 266)
Name: NF2750_low_16
Description: NF2750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2750_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 26 - 159
Target Start/End: Original strand, 10472293 - 10472426
Alignment:
| Q |
26 |
attattcttaaagtatagttctaagatgatgatagcacgacaaattaatggattcttataaaatgtatgtgtaaaattgacaatgaaattgtatgttctt |
125 |
Q |
| |
|
|||| ||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10472293 |
attagtcttaaaatatagttctaagatgaggatagcacgacaaattaatggattcttataaaatgtatgtgtaaaattgacaataaaattgtatgttctt |
10472392 |
T |
 |
| Q |
126 |
taaacaagtaacaacattagtatttacgaagaag |
159 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
10472393 |
taaacaagtaataacattagtatttacgaagaag |
10472426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 223 - 266
Target Start/End: Original strand, 10472490 - 10472531
Alignment:
| Q |
223 |
ctaccaacatatataaaattttatgtatatctacaacttactta |
266 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10472490 |
ctaccaacatatataa--ttttatgtatatctacaacttactta |
10472531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University