View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2750_low_17 (Length: 265)
Name: NF2750_low_17
Description: NF2750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2750_low_17 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 32 - 265
Target Start/End: Complemental strand, 35298203 - 35297970
Alignment:
| Q |
32 |
cctgtgcttactctatctataatttgttaactaaggttaaacaagaattttgaactttataaagccaaaacctttagttttaattcaaaatttcttcatc |
131 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35298203 |
cctgtgctttatctatctataatttgttaactaaggttaagcaagaattttgaactttataaagccaaaacctttagttttaattcaaaatttcttcatc |
35298104 |
T |
|
| Q |
132 |
ttttgcttggaagtaaagttttacaaaatgttgatttgtcggtcagtttggttacttgcccgtttgatcttgtactctggttctatataaactctatttc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35298103 |
ttttgcttggaagtaaagttttacaaaattttgatttgtcggtcagtttggttacttgcccgtttgatcttgtactctggttctatataaactctatttc |
35298004 |
T |
|
| Q |
232 |
tgttgacttgtttctgaggttatcacttggtctt |
265 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
35298003 |
tgttgacttgtttctggggttatcacttggtctt |
35297970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University