View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2750_low_20 (Length: 251)
Name: NF2750_low_20
Description: NF2750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2750_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 16 - 121
Target Start/End: Complemental strand, 33866189 - 33866086
Alignment:
| Q |
16 |
agatacaataaaatattaaatgaatgcataaaaagttgggatgttaaataatcattgttgatattaaatacatcaaagttataaaatagtttttcaagat |
115 |
Q |
| |
|
||||| |||||| ||||||||||||| ||||||||||||| |||| ||| ||||||||||||||||| |||||| ||||||||||||||| ||||| ||| |
|
|
| T |
33866189 |
agatataataaagtattaaatgaatgtataaaaagttggggtgtttaat-atcattgttgatattaagtacatc-aagttataaaatagtatttcacgat |
33866092 |
T |
 |
| Q |
116 |
ttttat |
121 |
Q |
| |
|
|||||| |
|
|
| T |
33866091 |
ttttat |
33866086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 158 - 249
Target Start/End: Complemental strand, 33866025 - 33865939
Alignment:
| Q |
158 |
tatattttaagaataatttaattttatgaagtactactagttagcataatatttttatatttttatagatggtcattgattgctgcaagact |
249 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| ||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33866025 |
tatattttaaaaataatttaattgtatgaagta-----agtaagcatgatatttttatatttttatagatggtcattgattgctgcaagact |
33865939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University