View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2750_low_23 (Length: 237)
Name: NF2750_low_23
Description: NF2750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2750_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 3e-87; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 6 - 223
Target Start/End: Complemental strand, 13467848 - 13467631
Alignment:
| Q |
6 |
gaaactagctagtactcatctttgggtcggttcatactaggttttgctcagacttcaattgagcctcccgctagtagatggtggaattgaccccnnnnnn |
105 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13467848 |
gaaactaactaatactcatctttgggtcggttcatactaggttttactctgacttcaattgagcctcccgctagtagacggtggaattgacccaaaaaaa |
13467749 |
T |
|
| Q |
106 |
nnngctagcactcacctttgcacaagcttaggcttggtgagctatgttggaatttgatcccttaaacactttgaagccctaaaaatttgggatttgttga |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13467748 |
aaagctagcactcacctttgcacaagcttaggcttggtgagctatgttggaatttgagcccttaaacactttgaagccctaaaaatttgggatttgttga |
13467649 |
T |
|
| Q |
206 |
tataattaagttcataat |
223 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
13467648 |
tataattaagttcataat |
13467631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 90
Target Start/End: Complemental strand, 6021110 - 6021068
Alignment:
| Q |
48 |
tttgctcagacttcaattgagcctcccgctagtagatggtgga |
90 |
Q |
| |
|
||||||| |||||||||||| |||||||||||| ||||||||| |
|
|
| T |
6021110 |
tttgctctgacttcaattgaacctcccgctagtggatggtgga |
6021068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 13471485 - 13471432
Alignment:
| Q |
1 |
attgtgaaactagctagtactcatctttgggtcggttcatactaggttttgctc |
54 |
Q |
| |
|
||||||||||||||||||||| | ||||| ||| |||||||| |||||| |||| |
|
|
| T |
13471485 |
attgtgaaactagctagtactaacctttgcgtcagttcatacaaggtttcgctc |
13471432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 217
Target Start/End: Original strand, 33331769 - 33331820
Alignment:
| Q |
166 |
cttaaacactttgaagccctaaaaatttgggatttgttgatataattaagtt |
217 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| ||||||||||| |||| |
|
|
| T |
33331769 |
cttaaacactttgaagccctcaagatttgggatttattgatataattgagtt |
33331820 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 182 - 219
Target Start/End: Complemental strand, 3504683 - 3504646
Alignment:
| Q |
182 |
ccctaaaaatttgggatttgttgatataattaagttca |
219 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
3504683 |
ccctaataatttgggatttattgatataattaagttca |
3504646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University