View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2751_high_8 (Length: 207)
Name: NF2751_high_8
Description: NF2751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2751_high_8 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 12125569 - 12125363
Alignment:
| Q |
1 |
ataataatattgtgcatggtgttagtatcaccaaaggtttacacccgcaggcagcgagtgaaccgccaccaacagggcactcaacacccaaggggagcaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12125569 |
ataataatattgtgcatggtgttagtatcaccaaaggtttacacccgcaggcagcgagtgaaccgccaccaacagggcactcaacacccaaggggtgcaa |
12125470 |
T |
 |
| Q |
101 |
gtcatccaacagtcacgacccacccaaggggtgcagggttaagagatgcgaatcaaagaggcatgacacttggtgtagagactcatccagtggggccaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||||||| |||||||||||||||||| |||||||||||||| ||||||| ||||||||| |
|
|
| T |
12125469 |
gtcatccaacagtcacgacccacccaagtggggcagggttaagagatgtgaatcaaagaggcatgacccttggtgtagagacgcatccagcggggccaag |
12125370 |
T |
 |
| Q |
201 |
aagggcg |
207 |
Q |
| |
|
||||||| |
|
|
| T |
12125369 |
aagggcg |
12125363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 34 - 206
Target Start/End: Complemental strand, 4416655 - 4416482
Alignment:
| Q |
34 |
aaggtttacacccgcaggcagcgagtgaaccgccaccaacagggcactcaacacccaaggggagcaagtcatccaacagtcacgaccca-cccaaggggt |
132 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| |||||||||||||||||||||||||| ||| |||| ||||||||||| ||||| |||||| ||| |
|
|
| T |
4416655 |
aaggtttacacccaaaggcagcgagtgaaccaccagcaacagggcactcaacacccaaggggtgcaggtcacccaacagtcacaacccaccccaagaggt |
4416556 |
T |
 |
| Q |
133 |
gcagggttaagagatgcgaatcaaagaggcatgacacttggtgtagagactcatccagtggggccaagaagggc |
206 |
Q |
| |
|
||||||||||||||||||| | |||||||| |||| |||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
4416555 |
gcagggttaagagatgcgacttaaagaggcgtgacccttggtgtagagacacatccagtggggccaagaggggc |
4416482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University