View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2752_high_25 (Length: 324)
Name: NF2752_high_25
Description: NF2752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2752_high_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 76 - 226
Target Start/End: Complemental strand, 27356099 - 27355949
Alignment:
| Q |
76 |
tgaaatccatccaaatagaaaaagaactattacagtccctaagaacgtgaacgtcagattcaatagaaattttgcacctttggcatgaagagtttgaagt |
175 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27356099 |
tgaaatccatccaaataggaaaagaactattacagtccctaagaacgtgaacgtcagattcaatagaaattttgcacctttggcatgaagagtttgaagt |
27356000 |
T |
|
| Q |
176 |
gatatatgtctagattatctgagaaggttggttggacttggaagtcaacca |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27355999 |
gatatatgtctagattatctgagaaggttggttggacttggaagtcaacca |
27355949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University