View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2752_high_35 (Length: 264)
Name: NF2752_high_35
Description: NF2752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2752_high_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 55 - 254
Target Start/End: Original strand, 42648599 - 42648798
Alignment:
| Q |
55 |
tttaccaaatcaatttttgtgatggcagaatcaaacacactggtaatctattaggtaaatttatgttgaatttgactgaatttgtattgttgtggtggag |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |||||||| | |
|
|
| T |
42648599 |
tttaccaaatcaatttttgtgatggcagaatcaaacacactggtaatctagtaggtaaatttatgttgaatttgactgaatctgtattgctgtggtgggg |
42648698 |
T |
 |
| Q |
155 |
ccttgcagaccatccaggcagggcgttggagtgtaaaagattacttaggaagtgagtcgctgttttcaccaaaggaatggaggtatatggaaaatctgtg |
254 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42648699 |
ccttgcagactatccaggcagggcgttggagtgtaaaagattacttaggaagtgagtcgctgttttcaccaaaggaatggaggtatatggaaaatctgtg |
42648798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University