View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2752_high_39 (Length: 238)
Name: NF2752_high_39
Description: NF2752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2752_high_39 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 37160758 - 37160538
Alignment:
| Q |
18 |
gatgtagggtcatcggcagcactggctctgatgataaggtaacctatcatttcttttcnnnnnnnctctatttgaaatcactagatcatggacccgtgcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37160758 |
gatgtagggtcatcggcagcactggctctgatgataaggtaacctatcatttcttttctttttttctctatttgaaatcactagatcatggacccgtgcg |
37160659 |
T |
 |
| Q |
118 |
atgcatgttgggcacaattgtttgaaattgtatatatctaacaaacttcaagcacatccatagtttgacagaggagaaaacaatacgtcattaaaaaaca |
217 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
37160658 |
atgcatgttgggcataattgtttgaaattgtatatatctaacagacttcaagcacatccatagtgtgacagaggagaaaacaatacgtcattaaaaaata |
37160559 |
T |
 |
| Q |
218 |
tgtaatcttttgctaaaacat |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
37160558 |
tgtaatcttttgctaaaacat |
37160538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 37149624 - 37149579
Alignment:
| Q |
18 |
gatgtagggtcatcggcagcactggctctgatgataaggtaaccta |
63 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37149624 |
gatgtcgggtcattggcagcactggctctgatgataaggtaaccta |
37149579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University