View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2752_high_43 (Length: 213)
Name: NF2752_high_43
Description: NF2752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2752_high_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 20 - 130
Target Start/End: Original strand, 37718779 - 37718889
Alignment:
| Q |
20 |
ataaattcataatgggacgaaataaaagaaagatataaataaaatgatgagttaaataagtgtaggaaaaggtgggatgtttaaatattatggttgatta |
119 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
37718779 |
ataaatttataatgggacgaaataaaagaaagatataaataaaatgatgagttaaataagtgtaggaaaaagtgggatgttcaaatattatggttgatta |
37718878 |
T |
|
| Q |
120 |
taaaataacgt |
130 |
Q |
| |
|
||||||||||| |
|
|
| T |
37718879 |
taaaataacgt |
37718889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University