View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2752_low_24 (Length: 326)
Name: NF2752_low_24
Description: NF2752
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2752_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 162 - 310
Target Start/End: Complemental strand, 55179676 - 55179528
Alignment:
| Q |
162 |
gcctaagcttatgtgttggaattgaggttattaaccaaggagctagtggggatgttgaggttcttaactataatgttcttgactatggtgccaaaggtga |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
55179676 |
gcctaagcttatgtgttggaattgaggttattaaccaaggagctagtggggatgttgaggttcttaactataatgttcttgactatgctgccaaagttga |
55179577 |
T |
 |
| Q |
262 |
tggcgaaaccgatgattcggatgtatgtaatttttactattgtcatatt |
310 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55179576 |
tggcgaaactgatgattcggatgtatgtaatttttactattgtcatatt |
55179528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 55179855 - 55179772
Alignment:
| Q |
20 |
ttatttgcattcacaaaaaagattgtatttctaattatatttttcagcagcatttgacactccaacaaagtctatatattgtac |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
55179855 |
ttatttgcattcacaaaaaagattgtatttctaattatatttttcagcagcatttgacactccaaaaaagtctatatattgtac |
55179772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University