View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2753_high_33 (Length: 329)

Name: NF2753_high_33
Description: NF2753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2753_high_33
NF2753_high_33
[»] chr8 (1 HSPs)
chr8 (9-317)||(31796510-31796818)
[»] chr5 (2 HSPs)
chr5 (41-192)||(8938252-8938403)
chr5 (41-117)||(8946610-8946686)


Alignment Details
Target: chr8 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 9 - 317
Target Start/End: Complemental strand, 31796818 - 31796510
Alignment:
9 agatgaagcaattggaagagaggaaagggcattgatagtatcaaagagcatatacatagtgtgcataggaagtgatgacattgctaatacttatgctcaa 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31796818 agatgaagcaattggaagagaggaaagggcattgatagtatcaaagagcatatacatagtgtgcataggaagtgatgacattgctaatacttatgctcaa 31796719  T
109 acaccatttcggcgttttcagtatgatattcaatcatacacagatttcatggcttctgaagcctcaaaattcttgcaggtatgtctttggaatacacata 208  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
31796718 acaccatttcgacgttttcagtatgatattcaatcatacacagatttcatggcttatgaagcctcaaaattcttgcaggtatgtctttggaatacacata 31796619  T
209 tgaaccataatattgcggtaaaatactgtcattgtagtcacagttgcagttgcgttgtcattgcatagatctctgaaatcttaatattgcggccgcaatt 308  Q
    ||||||||||||||| |||||||||| |||| |||||||||| ||||||||| | || ||||||| |||||||| ||||| | |||||||||||||||||    
31796618 tgaaccataatattgtggtaaaatacggtcactgtagtcacaattgcagttgtgatgccattgcagagatctctaaaatcattatattgcggccgcaatt 31796519  T
309 gtggttgca 317  Q
    |||||||||    
31796518 gtggttgca 31796510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 56; Significance: 3e-23; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 41 - 192
Target Start/End: Original strand, 8938252 - 8938403
Alignment:
41 tgatagtatcaaagagcatatacatagtgtgcataggaagtgatgacattgctaatacttatgctcaaacaccatttcggcgttttcagtatgatattca 140  Q
    ||||| ||||||||||  |||||||  | |||||||||||| |||||||||| |||||||||||||||||||||| | || |  |  ||||||||||||     
8938252 tgataatatcaaagagtgtatacattatttgcataggaagtaatgacattgccaatacttatgctcaaacaccatataggagagtgaagtatgatattcg 8938351  T
141 atcatacacagatttcatggcttctgaagcctcaaaattcttgcaggtatgt 192  Q
    |||||||||||| ||  |||||||  | |||||||| |||||||| ||||||    
8938352 atcatacacagacttattggcttcatatgcctcaaacttcttgcaagtatgt 8938403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 117
Target Start/End: Original strand, 8946610 - 8946686
Alignment:
41 tgatagtatcaaagagcatatacatagtgtgcataggaagtgatgacattgctaatacttatgctcaaacaccattt 117  Q
    ||||| ||||||||||  |||||||  | ||||||||   |||||||||||| ||||||||| ||||||||||||||    
8946610 tgataatatcaaagagtgtatacattatttgcataggggctgatgacattgccaatacttattctcaaacaccattt 8946686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University