View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2753_high_39 (Length: 288)
Name: NF2753_high_39
Description: NF2753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2753_high_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 24 - 261
Target Start/End: Complemental strand, 52770567 - 52770331
Alignment:
| Q |
24 |
agaaaacttagctcaaaactagaaaatttattttcaataaaaattctctctatttaagtattggaaactttactagcaacttagtaattcactgactagt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52770567 |
agaaaacttagctcaaaactagaaaatttattttcaatcaaaattctctctattttagtattggaaactttactagcaactttgtaattcactgactagt |
52770468 |
T |
|
| Q |
124 |
ggtatggttatggtattctttgttgttgacttattggaacatgaaaggaagtttaggaatggtatgacggtgatgttgacaataactgtggtggcagtga |
223 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52770467 |
ggtatggt-atggtattctttgttgttgacttattggaacatgaaaggaagtttaggaatggtatgacggtgatgttgacaataactgtggcggcagtga |
52770369 |
T |
|
| Q |
224 |
agatctgatgtaaaagcactgtatatgatgtcaattgt |
261 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52770368 |
agatctgatgtaaaagcactatatatgatgtcaattgt |
52770331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University