View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2753_high_60 (Length: 237)
Name: NF2753_high_60
Description: NF2753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2753_high_60 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 31796170 - 31795952
Alignment:
| Q |
1 |
acttaaaaaggattgggatgcaggaactatacagactaggaggtagaaggattggagtatttgatgtaccagttatagggtgtgtgccctcacaaagaac |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31796170 |
acttaaaaaggattggggtgcaggaactatacagactaggaggtagaaggattggagtatttgatgtaccagttatagggtgtgtgccctcacaaagaac |
31796071 |
T |
|
| Q |
101 |
acttggtggaggcatttttagagaatgttcaaattcttctaatcaagcagcaatgctcttcaattctaagcttttcaaagaaatgagggcacttggaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31796070 |
acttggtggaggcatttttagagaatgttcaaattcttctaatcaagcagcaatgctcttcaattctaagcttttcaaagaaatgagggcacttggaaaa |
31795971 |
T |
|
| Q |
201 |
gagtactcagatgctagat |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
31795970 |
gagtactcagatgctagat |
31795952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 21 - 116
Target Start/End: Original strand, 8939329 - 8939424
Alignment:
| Q |
21 |
caggaactatacagactaggaggtagaaggattggagtatttgatgtaccagttatagggtgtgtgccctcacaaagaacacttggtggaggcatt |
116 |
Q |
| |
|
||||||||||| | |||||| |||||||||||||||| ||| | | ||| ||||||||||||||||||||| |||||| |||| ||||||||| |
|
|
| T |
8939329 |
caggaactatatggtttaggagctagaaggattggagtaattggtatgccaaatatagggtgtgtgccctcacagagaacaattggaggaggcatt |
8939424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University