View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2753_high_61 (Length: 236)
Name: NF2753_high_61
Description: NF2753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2753_high_61 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 13 - 222
Target Start/End: Complemental strand, 39485855 - 39485646
Alignment:
| Q |
13 |
atttatcaataggtgaagtaaggcggtaaatggaattcctccgaacaaatttgcactattcttaatgttggtgagagctgttttggtatcgctattaaag |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39485855 |
atttatcaataggtgaagtaaggcggtaaatggaattcctccgaacaaatttgcactattcttaatgttggtgagagctcttttggtatcgctattaaag |
39485756 |
T |
 |
| Q |
113 |
ttggatctctaacttttttagagtcttttgaggatctgccgatattcttcattttcatgtcgagtttcatgttacccatcaaggtcttattctgactatg |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
39485755 |
ttggatctctaacttttttagactcttttgaggatcttccgatattcttcattttcatgtggagtttcatgttactcgtcaaggtcttattctgactatg |
39485656 |
T |
 |
| Q |
213 |
cacttgaatt |
222 |
Q |
| |
|
| ||||||| |
|
|
| T |
39485655 |
tagttgaatt |
39485646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University