View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2753_low_23 (Length: 403)
Name: NF2753_low_23
Description: NF2753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2753_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 4e-91; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 191 - 384
Target Start/End: Original strand, 7366990 - 7367181
Alignment:
| Q |
191 |
tttatagaatcactttacgttttaaaaatcctaaatcacatgcacacgccctcgaccatttcttttcacttattgcatacatcacaaagacattttttat |
290 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
7366990 |
tttatagaatcactttacgttt-aaaaatcctaaatcacatgcacacgccctcgaccatttcttatcacttattgcatacatcacaa-gacattttttat |
7367087 |
T |
 |
| Q |
291 |
gcttcatatcgagcttgtttcttgcaaactcatttctgacacctactattagctttagtaattaattactataagtgtgcttgatatttttacc |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7367088 |
gcttcatatcgagcttgtttcttgcaaactcatttctgacacccactattagctttagtaattaattactataagtgtgcttgatatttttacc |
7367181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 31 - 191
Target Start/End: Original strand, 7366757 - 7366917
Alignment:
| Q |
31 |
gtaaatcgataatataagtgagatttgttagatacaaatgaatcataaactctagaaaatcactatggtaaagcttagctagtatgtatttcaaaattga |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7366757 |
gtaaatcgataatataagtgagatttgttagatacaaatgaatcataaactctagaaaatcactatggtaaagctttgctagtatgtatttcaaaattga |
7366856 |
T |
 |
| Q |
131 |
ttgtgagatgagttttggttaaaaataagctgaaattaaacattaatatatttgaagttgt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7366857 |
ttgtgagatgagttttggttaaaaataagctgaaattaaacattaatatatttgaagttgt |
7366917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 7366585 - 7366617
Alignment:
| Q |
1 |
tagatatattagaaagtagaaacaaactttgta |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7366585 |
tagatatattagaaagtagaaacaaactttgta |
7366617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University