View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2753_low_30 (Length: 376)
Name: NF2753_low_30
Description: NF2753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2753_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 343; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 343; E-Value: 0
Query Start/End: Original strand, 18 - 364
Target Start/End: Complemental strand, 49576182 - 49575836
Alignment:
| Q |
18 |
gtatgaccgtgaagagtcttcacaagcgaacccgtcggaacatcccataaacggatggttttgtcgtcggaggcggagacaaggtagcgggaatcggagg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49576182 |
gtatgaccgtgaagagtcttcacaagcgaacccgtaggaacatcccataaacggatggttttgtcgtcggaggcggagacaaggtagcgggaatcggagg |
49576083 |
T |
 |
| Q |
118 |
agaaagcgaggtcggaaacgccgtgctgatggccttcgtattgttgcataggagaaagagtgaggctgttggaatcggaatcggagttagtgaagccata |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49576082 |
agaaagcgaggtcggaaacgccgtgctgatggccttcgtattgttgcataggagaaagagtgaggctgttggaatcggaatcggagttagtgaagccata |
49575983 |
T |
 |
| Q |
218 |
agtgcggagggttttgtcggcggaggaggaggcgaggagacggccgttggaggagaatttgacggcggagatggcgcgtttgtggccggttagggtttgg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49575982 |
agtgcggagggttttgtcggcggaggaggaggcgaggagacggccgttggaggagaatttgacggcggagatggcgcgtttgtggccggttagggtttgg |
49575883 |
T |
 |
| Q |
318 |
gaaagtgtgtagggtttgtagtttgaggaatcacagtccattggttc |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49575882 |
gaaagtgtgtagggtttgtagtttgaggaatcacagtccattggttc |
49575836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University