View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2753_low_52 (Length: 248)

Name: NF2753_low_52
Description: NF2753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2753_low_52
NF2753_low_52
[»] chr4 (2 HSPs)
chr4 (130-213)||(45100679-45100762)
chr4 (35-68)||(45100584-45100617)
[»] chr1 (3 HSPs)
chr1 (130-213)||(12228859-12228942)
chr1 (130-207)||(35166998-35167074)
chr1 (35-68)||(12228764-12228797)


Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 130 - 213
Target Start/End: Original strand, 45100679 - 45100762
Alignment:
Q  130 gactcaaagtagtttaaatttcattcaattcaatttgattattgcaatattcgaatatgtaagatgggtggtaaatttctttat 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  45100679 gactcaaagtagtttaaatttcattcaattcaatttgattattgcaatattcgaatatgtaagatgggtggtaaatttatttat 45100762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 68
Target Start/End: Original strand, 45100584 - 45100617
Alignment:
Q  35 gacgcttaaaagatgggaaggacgacaattagta 68  Q
    ||||||||||||||||||||||||||||||||||    
T  45100584 gacgcttaaaagatgggaaggacgacaattagta 45100617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 72; Significance: 7e-33; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 130 - 213
Target Start/End: Original strand, 12228859 - 12228942
Alignment:
Q  130 gactcaaagtagtttaaatttcattcaattcaatttgattattgcaatattcgaatatgtaagatgggtggtaaatttctttat 213  Q
    ||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  12228859 gactcaaagtagtttaaattttattcaatttaatttgattattgcaatattcgaatatgtaagatgggtggtaaatttatttat 12228942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 130 - 207
Target Start/End: Complemental strand, 35167074 - 35166998
Alignment:
Q  130 gactcaaagtagtttaaatttcattcaattcaatttgattattgcaatattcgaatatgtaagatgggtggtaaattt 207  Q
    |||||||| |||||||||||| |||||||| ||||||||||||||||||||| |||||||||||||||||||||||||    
T  35167074 gactcaaa-tagtttaaattttattcaatttaatttgattattgcaatattcaaatatgtaagatgggtggtaaattt 35166998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 68
Target Start/End: Original strand, 12228764 - 12228797
Alignment:
Q  35 gacgcttaaaagatgggaaggacgacaattagta 68  Q
    ||||||||||||||||||||||||||||||||||    
T  12228764 gacgcttaaaagatgggaaggacgacaattagta 12228797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University