View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2753_low_53 (Length: 247)
Name: NF2753_low_53
Description: NF2753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2753_low_53 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 3611513 - 3611742
Alignment:
| Q |
18 |
atcccatgattccatgtcccactttcttgtctttggaatatcaacggttctgtttttgttcacaaccttaataaaattatagctttatgagctccattta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3611513 |
atcccatgattccatgtcccactttcttgtctttggaatatcaacggttctgtttttgttcacaaccttaataaaattatagctttatgagctccattta |
3611612 |
T |
 |
| Q |
118 |
ttaccacatgtgtaccttattataatttattttcatcatttttacatatattnnnnnnntagataatattgtacctaaaaatgtattagataatgtgctt |
217 |
Q |
| |
|
||||||||||||||||||||| |||| | ||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||| || |
|
|
| T |
3611613 |
ttaccacatgtgtaccttattttaatctcttttcatcatttttacatatattaaaaaaatagataatgttgtacctaaaaatatattagataatgtgttt |
3611712 |
T |
 |
| Q |
218 |
tatgtgacaattttatgtatggatattcct |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3611713 |
tatgtgacaattttatgtatggatattcct |
3611742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University