View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2753_low_61 (Length: 237)
Name: NF2753_low_61
Description: NF2753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2753_low_61 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 8 - 221
Target Start/End: Original strand, 36346324 - 36346537
Alignment:
| Q |
8 |
atgaactatgtttacgtgacgtccaacatctagttttaatgacatcaattaatttactatacccaaccacaataaccatcgttataggttttacgggtga |
107 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36346324 |
atgaactatgttcacgtgacgtccaacatctagttttaatgacatcaattaatttactatacccaaccacaataaccatcgttataggttttacgggtga |
36346423 |
T |
 |
| Q |
108 |
cacatcttaattgcagctgaagtaataaaatattttgttttgagttgtcttgttgttgtgtagatacaactcacgnnnnnnnnnnnnttaccaagactac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
36346424 |
cacatcttaattgcagctgaagtaataaaatattttgttttgagttttcttgttgtgttgtagatacaactcacgaaaaaacaaaaattaccaagactac |
36346523 |
T |
 |
| Q |
208 |
agttttgtggtcaa |
221 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36346524 |
agttttgtggtcaa |
36346537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University