View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2753_low_66 (Length: 222)
Name: NF2753_low_66
Description: NF2753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2753_low_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 18 - 205
Target Start/End: Complemental strand, 48321263 - 48321078
Alignment:
| Q |
18 |
atgaaatgaccataactattagaaacatatataaatagagaagtcgaggttcaaaccccaatcacatcattcgatttaatgattacaatatttttacatg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| ||||||||||| |||||||||||||||| | |
|
|
| T |
48321263 |
atgaaatgaccataactattagaaacatatataaatagagaagtcgaggttcaaa-cccgatcacatcgttcgatttaataattacaatatttttaccag |
48321165 |
T |
 |
| Q |
118 |
ttgagttaggtgaaccacaaatttaagaccttactcgagacaaattgannnnnnnnatgaaaattatttaaacacatgataaaaaagg |
205 |
Q |
| |
|
|||||||||||||||||||||||| ||||| || | ||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
48321164 |
ttgagttaggtgaaccacaaattttagacc-tatttgagacaaatcgatttttttaatgaaaattatttaaacacatgataaaaaagg |
48321078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University