View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2754_high_10 (Length: 250)
Name: NF2754_high_10
Description: NF2754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2754_high_10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 45758612 - 45758375
Alignment:
| Q |
13 |
aatatcatatctgcgttttacattagggttataggatttttggtcttcactttcaaacggtataccaattatatgcaaaatataaatttaattatccact |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45758612 |
aatatcatatctgcgttttacattagggttataggatttttggtcttcactttcaaacggtataccaattatatgcaaaatataaatttaattatccacg |
45758513 |
T |
|
| Q |
113 |
tacaatattgacaaaactaaatggacaaaccatatacgaatacggagtgaatgttgtaccacgattcacaacaaaccaataatttgaagttaatcattgt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45758512 |
tacaatattgacaaaactaaatggacaaaccatatacgaatacggagtgaatgttgtaccacgattcacaacaaaccaataatttgaagttaatcattgt |
45758413 |
T |
|
| Q |
213 |
tgtccggaagctattgtaataatggtacataaaaatat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45758412 |
tgtccggaagctattgtaataatggtacataaaaatat |
45758375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University