View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2754_high_14 (Length: 227)
Name: NF2754_high_14
Description: NF2754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2754_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 7 - 213
Target Start/End: Original strand, 12672677 - 12672882
Alignment:
| Q |
7 |
gtataatctagacaacactgttgttgtcagagtgcacaatttcacaagtttgagtttaacaaaatcttgcgtgcaaagttatgttataattcactaattt |
106 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12672677 |
gtataatctagacaacactgtt---gtcagagtgcacaatttcacaagtttgagtttaacaaaatcttgcgtgcaaagttatgttataattcactaattt |
12672773 |
T |
 |
| Q |
107 |
tcaaactaattagcacaaaaatcaagtttgcaatgataatcataata--ataaccaaacnnnnnnnnttagtggttggtttgaataagacccatgtggat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12672774 |
tcaaactaattagcacaaaaatcaagtttgcaatgataatcataataatataaccaaacaaaaaaaattagtggttggtttgaataagacccatgtggat |
12672873 |
T |
 |
| Q |
205 |
ggcattgaa |
213 |
Q |
| |
|
||||||||| |
|
|
| T |
12672874 |
ggcattgaa |
12672882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University