View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2754_low_5 (Length: 345)
Name: NF2754_low_5
Description: NF2754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2754_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 11088988 - 11088778
Alignment:
| Q |
1 |
attattattcaatttgtccacttcttatcacattgttattttggtcagccaatcatgccccttaatcaatgtttaaaactaaaccggatggttcaactag |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11088988 |
attagtattcaatttgtccacttcttatcacattgttattttggtcagccaatcatgccccttaatcaatgtttaaaactaaaccggatggttcaactag |
11088889 |
T |
|
| Q |
101 |
ttgaatcgggaatcggtttattttataatcggtttgatccttgttgtattacagtctggttgaatcaaattgaacaaaggtaaatcgattcaactgtagt |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11088888 |
ttgaattgggaatcggtttattttataatcggtttgatccttgttgtattacagtctggttgaatcaaattgaacaaaggtaaatcgattcaactgtagt |
11088789 |
T |
|
| Q |
201 |
tggttcaacca |
211 |
Q |
| |
|
| ||||||||| |
|
|
| T |
11088788 |
tagttcaacca |
11088778 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 263 - 325
Target Start/End: Complemental strand, 11088726 - 11088664
Alignment:
| Q |
263 |
gtctaatagttaaatcgtagttgagccaatcgagtcaagatctgaatgtctcaccgattcaat |
325 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
11088726 |
gtctaatagtttaatcgtagttgaaccaatcgagtcaagatctgaatgtctcactgattcaat |
11088664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University