View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2754_low_8 (Length: 284)
Name: NF2754_low_8
Description: NF2754
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2754_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 12 - 142
Target Start/End: Complemental strand, 40679331 - 40679201
Alignment:
| Q |
12 |
agagatagaatgatgaaatactctagtgatggataaatatatctctattatccgtaactaaaccagtgttttaaaccaagtgatagaatttgtgatggaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40679331 |
agagatagaatgatgaaatactctagtgatggataaatatatctctattatccgtaactaaaccagtgttttaaaccaagtgatagaatttgtgatggaa |
40679232 |
T |
 |
| Q |
112 |
ctgtttgtgagggatacacttttgtctaatt |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40679231 |
ctgtttgtgagggatacacttttgtctaatt |
40679201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 174 - 268
Target Start/End: Complemental strand, 40679200 - 40679106
Alignment:
| Q |
174 |
ttacaaggtattttaatcgcctaatttgtcgacaatgtcatgtgagaattgaacatcttcggcgaacaacggtgaagactaaatcattgaactag |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
40679200 |
ttacaaggtattttaatcgcctaatttgtcgacaatgccatgtgaggattgaacatcttcgacgaacaacggtgaagactaaatcattgaactag |
40679106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University